Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

20 Commits
 
 
 
 
 
 
 
 

Repository files navigation

Trimitomics: An efficient pipeline for mitochondrial assembly from transcriptomic reads in non-model species

Author(s): Bruna Plese, Maria Eleonora Rossi, Nathan James Kenny, Sergi Taboada, Vasiliki Koutsouveli, and Ana Riesgo

How to cite: Plese B, Rossi ME, Kenny N, Taboada S, Koutsouveli V, Riesgo A (2019) Trimitomics: An efficient pipeline for mitochondrial assembly from transcriptomic reads in non-model species. Molecular Ecology Resources https://doi.org/10.1111/1755-0998.13033

Data

The datasets used are deposited at NCBI Sequence Read Archive (SRA) https://www.ncbi.nlm.nih.gov/sra. Conversion from SRA file format to FASTQ is done using fastq-dump (with –readids and –split-files parameters) from SRAtoolkit.2.8.2. All the reads used were paired end but single end reads can be used as well. Check the quality of reads using FastQC; for more files you can use MultiQC.

Minimum prerequisites

  • NOVOPlasty version 2.7.1 and an appropriately filled out config file (example given here)
  • Bowtie2
  • Trinity version v2.8.4
  • Velvet 1.2.10

Mitochondrial genome recovery from RNA-seq data; in the following steps arthropod Thermobia domestica is used as an example

  • The proposed pipeline uses 3 assemblies:
  1. NOVOPlasty (https://github.com/ndierckx/NOVOPlasty)
  2. Bowtie2/Trinity (https://github.com/trinityrnaseq/trinityrnaseq/wiki/Genome-Guided-Trinity-Transcriptome-Assembly)
  3. Velvet (https://github.com/dzerbino/velvet)

1. NOVOPlasty

Prepare config file (NOVOpl_config) using arthropod Thermobia_domestica (GenBank: AY639935.1) as reference genome. Remove the forward and reverse adapter sequence in the original raw reads.

  • Cutting the 5’ adapter sequence cutadapt -g AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -o Thermobia_domestica_adapterremove_R1.fq.gz Thermobia_domestica_R1.fq.gz&

  • Cutting the 3’ adapter sequence cutadapt -a CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -o Thermobia_domestica_adapterremove_R2.fq.gz Thermobia_domestica_R2.fq.gz&

  • start NOVOplasty script perl NOVOPlasty.pl -c NOVOpl_config.txt&

  • adapter sequence are specific adaptors used in library sequencing

  • use a suitable seed or reference genome for assembly - the closer related to your target the better

  • try different k-mer sizes (25, 39, 45, 51) in order to get better results

  • the output file contains either a complete circular genome or several contigs which will need to be assembled

2. Bowtie2/Trinity

Use Bowtie2 for alignment of raw reads with a reference mitochondrial genome. Extract reads that mapped to the reference mitochondrial genome. Commands:

  • clean the reads: java -jar /path/trimmomatic-0.33.jar PE -threads 8 -phred33 /path/Thermobia_domestica_R1.fq.gz /path/Thermobia_domestica_R2.fq.gz /path/Thermobia_domestica_R1_paired.fq.gz /path/Thermobia_domestica_R1_unpaired.fq.gz /path/Thermobia_domestica_R2_paired.fq.gz /path/Thermobia_domestica_R2_unpaired.fq.gz ILLUMINACLIP:Adapters.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:30& *NB: Adapters.fa file should include the specific adaptors used in library sequencing

  • make a bowtie_index folder: bowtie2-build /path/Thermobia_domestica.fasta bowtie_index/Tdomestica

  • alignment --local with paired reads: bowtie2 --fr --local -x bowtie_index/Tdomestica -1 /path/Thermobia_domestica_R1_paired.fq.gz -2 /path/Thermobia_domestica_R2_paired.fq.gz -S /path/Thermobia_domestica_BOWTIE.sam&

  • Convert SAM to BAM using samtools: samtools view -b -S -o /path/Thermobia_domestica.bam /path/Thermobia_domestica_BOWTIE.sam&

  • Extract only mapped reads: samtools view -b -F 4 /path/Thermobia_domestica.bam > /path/Thermobia_domestica_mapped.bam& #file size of output .bam file is small enough for easier further manipulation

  • genome guided Trinity assembly:

samtools sort /path/Thermobia_domestica_mapped.bam -o /path/Thermobia_domestica_mapped_sorted.bam&

/path/Trinity --genome_guided_bam /path/Thermobia_domestica_mapped_sorted.bam --max_memory 50G --genome_guided_max_intron 1000 --CPU 6 --output /path/trinity_out_dir --full_cleanup& > trinity.log&

*adjust intron size depending on the species, with genome_guided_max_intron 1000 *mitochondrial contigs that need to be further assembled will be in the folder trinity_out_dir; file name *_GG.txt

3. Velvet assembly

Run velvet for at first with a k-mer size 71:

  • use this if you want to use only paired reads: velveth velvet71 71 -shortPaired -separate -fastq.gz /path/Thermobia_domestica_R1_paired.fq.gz /path/Thermobia_domestica_R2_paired.fq.gz&

  • if you would like to include unpaired as well: (see velvet manual for additional options) velveth velvet71 71 -shortPaired -separate -fastq.gz /path/Thermobia_domestica_R1_paired.fq.gz /path/Thermobia_domestica_R2_paired.fq.gz -short /path/Thermobia_domestica_all_unpaired.fq.gz&

  • run velvetg, with a low coverage cutoff, to exclude sequencing errors: *if you work in the same folder there is no need to set the path. velvetg velvet71/ -min_contig_lgth 100 -cov_cutoff 3 > jobname.log&

  • In order to set a cutoff you blast the contigs that you got from velvetg above (in the velvet71 folder, file name contigs), using the cox1 seq of the most closest species you find:

makeblastdb -in contigs.fa -title Tdomestica_coxDB -out Tdomestica_coxDB -dbtype nucl&

blastn -query Thermobia_domestica_cox1.fa -db Tdomestica_coxDB -out Tdomestica_cox1_blastn.txt&

  • or you can perform blast with protein seq. we used this:

makeblastdb -in contigs.fa -title Tdomestica_coxDB -out Tdomestica_coxDB -dbtype nucl&

tblastn -query Thermobia_domestica_cox1.fa -db Tdomestica_coxDB -db_gencode 4 -out Tdomestica_cox1_blastt.txt&

*-db_gencode 4 is the translation code for sponge mitochondria; adjust it according to the species you would like to assemble *makeblastdb=make a database

velvetg velvet71/ -min_contig_lgth 100 -cov_cutoff 80 -max_coverage 170&

  • after that output file is contigs.fa in the folder velvet71

  • In the final contigs.fa file, if you are lucky, you will have mitodata in few contigs. If not, repeat step with blast, using known protein seq. of coding genes from the closest species possible. *if you still have gaps in your mitogenomes you can adjust the following:

  1. -k-mer size 31,51,71
  2. -cov_cutoff and -max_coverage (adjust -cov_cutoff to auto)

Final assembly

If the mt genome is not recovered by any of the three methods, the results can be combined as a meta-assembly in order to obtain the best results. This can be done using any alignment software (e.g. MAFFT).

Checkpoint

When the complete or almost complete mt genome is obtained, the assembly data is checked for homology with BlastN against the NCBI nr database. Further annotation is then performed on the web server MITOS2 (Bernt et al., 2013) using the appropriate translation table.

About

No description, website, or topics provided.

Resources

Stars

3 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors